View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17351_high_29 (Length: 250)
Name: NF17351_high_29
Description: NF17351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17351_high_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 83 - 233
Target Start/End: Complemental strand, 33254905 - 33254755
Alignment:
| Q |
83 |
agttttttgctctaacttttgctggtaattcaattttcttcaaatagtgcaaccactgcaatgtgataaacaatacaagttcattaataaattaaaatct |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33254905 |
agttttttgctctaacttttgctggtaattcaattttcttcaaatagtgcaaccactgcaatgtgataaacaatacaagttcattaataaattaaaatct |
33254806 |
T |
 |
| Q |
183 |
tcttagccttattttcgttttctatcaaataaaatgtgtaagcaataagtt |
233 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33254805 |
tcttagccttattttcgttttctgtcaaataaaatgtgtaagcaataagtt |
33254755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University