View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17351_low_16 (Length: 334)
Name: NF17351_low_16
Description: NF17351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17351_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 93 - 317
Target Start/End: Original strand, 28927246 - 28927469
Alignment:
| Q |
93 |
taatctaagatgttaacctccgttgatggtgagtttttgaaacaaaaagtcaattggtccatcagttagatgtgaagatggtttcaatgctgcattaaat |
192 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28927246 |
taatctaagatgttaacctctgttgatggtgaatttt-gaaacaaaaagtcaattggtccatcagttagatgtgaagatggtttcaatgctgcattaaat |
28927344 |
T |
 |
| Q |
193 |
gcttctcgaaactttgcatcttctttccatgacttggtagttgcttgctataacttggcatctctcagtatctcggattttgaaatgaaagatgaattaa |
292 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28927345 |
gcttctcaaaactttgcatcttctttccatgacttggtagttgcttgctctaacttggcatctctcagtatctcggattttgaaatgaaagatgaattaa |
28927444 |
T |
 |
| Q |
293 |
tttttacatctagtgacttcaattt |
317 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
28927445 |
tttttacatctagtgacttcaattt |
28927469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University