View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17351_low_19 (Length: 318)
Name: NF17351_low_19
Description: NF17351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17351_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 6170704 - 6170904
Alignment:
| Q |
1 |
aagctcaagcaaataatcaatttaatgtgacatctttttaatttttaaaatgcaagacacgggttgtggcaaattgaactttgtagacacaaaaaatgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6170704 |
aagctcaagcaaataatcaatttaatgtgacatctttttaatttttaaaatgcaagacacgggttgtggcaaattgaactttgtagacacaaaaaatgac |
6170803 |
T |
 |
| Q |
101 |
tataaaggtggggtggttcaatcaaaaacttcggtggaaatttgtcattagccaagtgagtagatcatatgcatttttttaattataaacaaaatataca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6170804 |
tataaaggtggggtggttcaatcaaaaacttcggtggaaatttgtcattagccaagtgagtagatcatatgcatttttttaattataaacaaaatataca |
6170903 |
T |
 |
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
6170904 |
t |
6170904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University