View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17351_low_30 (Length: 255)
Name: NF17351_low_30
Description: NF17351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17351_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 142 - 241
Target Start/End: Complemental strand, 14442539 - 14442440
Alignment:
| Q |
142 |
tgaaaataatgtccactagtcaacatgtgttgtcgtatgtttgtggtcactgatctgctctgttatacaaaacatcaatcctagtaacacaatcctggtc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14442539 |
tgaaaataatgtccactagtcaacatgtgttgtcgtatgtttgtggtcactgatctggtctgttagacaaaacatcaatcctagtaacacaatcctggtc |
14442440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 18 - 81
Target Start/End: Complemental strand, 14442663 - 14442600
Alignment:
| Q |
18 |
ttctcaatgttttgattggttatgcgtaaagtcgttttagaatgtcaacctaacaacattaaac |
81 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14442663 |
ttctgaatgttttgattggttatgcgtaaagtcgttttggaatgtcaacctaacaacattaaac |
14442600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University