View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17351_low_31 (Length: 250)

Name: NF17351_low_31
Description: NF17351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17351_low_31
NF17351_low_31
[»] chr4 (1 HSPs)
chr4 (83-233)||(33254755-33254905)


Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 83 - 233
Target Start/End: Complemental strand, 33254905 - 33254755
Alignment:
83 agttttttgctctaacttttgctggtaattcaattttcttcaaatagtgcaaccactgcaatgtgataaacaatacaagttcattaataaattaaaatct 182  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33254905 agttttttgctctaacttttgctggtaattcaattttcttcaaatagtgcaaccactgcaatgtgataaacaatacaagttcattaataaattaaaatct 33254806  T
183 tcttagccttattttcgttttctatcaaataaaatgtgtaagcaataagtt 233  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||    
33254805 tcttagccttattttcgttttctgtcaaataaaatgtgtaagcaataagtt 33254755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University