View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17352_low_6 (Length: 236)
Name: NF17352_low_6
Description: NF17352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17352_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 3 - 220
Target Start/End: Complemental strand, 28207477 - 28207260
Alignment:
| Q |
3 |
ggacatcatcatctttgttgtttgactcctttgtttcacctactactccaaactcattctcaaattcatcatgtgatgaccaattttttgcttcaacaac |
102 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28207477 |
ggacctcatcatctttgttgtttgactcctttgtttcacctactactccaaactcattctcaaattcatcatgtgatgaccaattttttgcttcaacaac |
28207378 |
T |
 |
| Q |
103 |
atcttgaacagtttcttcaccaacatttgattgataagttccaatgttgtcaataaaattccaaagatcataatctgattcccatggtatttcaatcaaa |
202 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28207377 |
atcttgaacagtctcttcaccaacatttgattgataagttccaatgttgtcaataaaattccaaagatcataatctgattcccatggtatttcaatcaaa |
28207278 |
T |
 |
| Q |
203 |
ttgtttggatcatcataa |
220 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
28207277 |
ttgtttggatcatcataa |
28207260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University