View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17353_high_3 (Length: 398)
Name: NF17353_high_3
Description: NF17353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17353_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 30 - 236
Target Start/End: Original strand, 47116736 - 47116940
Alignment:
| Q |
30 |
aatgaacgaatccccaatactgcagcacaatgagatggacatca-tccaagcttcctcatacccttgttatttcatttccttatgatatctcnnnnnnnc |
128 |
Q |
| |
|
|||||||||||||||||| || | |||||| ||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
47116736 |
aatgaacgaatccccaatccttc--cacaat-agatggacaccactccaagcttcctcatacccttgttatttcatttccttatgatatctctttttttc |
47116832 |
T |
|
| Q |
129 |
tgacattgttttgtttcatcgcttctcaggtaattacaatagttatattttatcaaagatattcaataaccaatttcttttatatctttagtttcaattc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116833 |
tgacattgttttgtttcatcgcttctcaggtaattacaatagttatattttatcaaagatattcaataaccaatttcttttatatctttagtttcaattc |
47116932 |
T |
|
| Q |
229 |
aatgagat |
236 |
Q |
| |
|
|| ||||| |
|
|
| T |
47116933 |
aaggagat |
47116940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 248 - 398
Target Start/End: Original strand, 47116972 - 47117118
Alignment:
| Q |
248 |
aaagcaaggtaagcaatatcaacgtatcaatgactcgatcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcggagaatgt |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116972 |
aaagcaaggtaagcaatatcaacgtatcaatgactcga----tcaccttttaacgattatttttaatttcttgttttgtagatggataggcggagaatgt |
47117067 |
T |
|
| Q |
348 |
atgataggcaacaaagctcaacgggaacgccaacatcaccatcttcgccgg |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
47117068 |
atgataggcaacaaagctcaacgggaacgccaacatcaccgtcttcaccgg |
47117118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University