View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17355_high_16 (Length: 236)
Name: NF17355_high_16
Description: NF17355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17355_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 72 - 213
Target Start/End: Complemental strand, 14490619 - 14490478
Alignment:
| Q |
72 |
gagtgtattttctcaagcgacaacattggaagtcaatgcttaaccactgattttcagtaccacttcaataaagagaatgctgtgtatctgaatctgtact |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14490619 |
gagtgtattttctcaagcgacaacattggaagtcaatgcttaaccactgattttcagtaccacttcaataaagagaatgctgcgtatctgaatctgtact |
14490520 |
T |
 |
| Q |
172 |
ttgatgatatgaatttttcggtgaaatgccctgattcttaaa |
213 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
14490519 |
ttgatgatatgaatttttcggtgaactgccttgattcttaaa |
14490478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University