View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17355_high_9 (Length: 271)
Name: NF17355_high_9
Description: NF17355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17355_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 11 - 100
Target Start/End: Complemental strand, 40869130 - 40869041
Alignment:
| Q |
11 |
agaatatgtccatgcaatggaggctatcaagtgggggactgactatttcatcaaggctcacacacaaccaaatgttctatgggtagaggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40869130 |
agaatatgtccatgcaatggaggctatcaagtgggggactgactatttcatcaaggctcacacacaaccaaatgttctatgggtagaggt |
40869041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 165 - 253
Target Start/End: Complemental strand, 40868976 - 40868888
Alignment:
| Q |
165 |
aatccacgagccgtggttgcaattgagataaataatccctctaagctagttggaaaaatagtactccacgaggtattcaaatgtcgaaa |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40868976 |
aatccacgagccgtggttgcaattgagataaataatccctctaagctagtcggaaaaatagtactacacgaggtattcaaatgtcgaaa |
40868888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University