View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17355_low_10 (Length: 310)
Name: NF17355_low_10
Description: NF17355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17355_low_10 |
 |  |
|
| [»] scaffold1974 (1 HSPs) |
 |  |  |
|
| [»] scaffold1878 (2 HSPs) |
 |  |  |
|
| [»] scaffold0290 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1974 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: scaffold1974
Description:
Target: scaffold1974; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 120 - 197
Target Start/End: Complemental strand, 101 - 24
Alignment:
| Q |
120 |
gtgtcaaaatggaatatgcatgatttccattaatttcaatatcattttctttcagcagaaagaaagaacaataatctg |
197 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
101 |
gtgtgaaaatggaatatgcatgatttccattaatttcaatttcattttctttcagcagaaagaaagaacaataatctg |
24 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1878 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: scaffold1878
Description:
Target: scaffold1878; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 120 - 197
Target Start/End: Original strand, 1173 - 1250
Alignment:
| Q |
120 |
gtgtcaaaatggaatatgcatgatttccattaatttcaatatcattttctttcagcagaaagaaagaacaataatctg |
197 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1173 |
gtgtgaaaatggaatatgcatgatttccattaatttcaatttcattttctttcagcagaaagaaagaacaataatctg |
1250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1878; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 135 - 197
Target Start/End: Original strand, 1 - 63
Alignment:
| Q |
135 |
atgcatgatttccattaatttcaatatcattttctttcagcagaaagaaagaacaataatctg |
197 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1 |
atgcatgatttccattaatttcaatttcattttctttcagcagaaagaaagaacaataatctg |
63 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0290 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: scaffold0290
Description:
Target: scaffold0290; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 120 - 197
Target Start/End: Complemental strand, 9013 - 8936
Alignment:
| Q |
120 |
gtgtcaaaatggaatatgcatgatttccattaatttcaatatcattttctttcagcagaaagaaagaacaataatctg |
197 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9013 |
gtgtgaaaatggaatatgcatgatttccattaatttcaatttcattttctttcagcagaaagaaagaacaataatctg |
8936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 120 - 196
Target Start/End: Complemental strand, 34083698 - 34083622
Alignment:
| Q |
120 |
gtgtcaaaatggaatatgcatgatttccattaatttcaatatcattttctttcagcagaaagaaagaacaataatct |
196 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34083698 |
gtgtgaaaatggaatatgcatgatttccattaatttcattttcattttctttcagcagaaagaaagaacaataatct |
34083622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 120 - 185
Target Start/End: Original strand, 23178312 - 23178377
Alignment:
| Q |
120 |
gtgtcaaaatggaatatgcatgatttccattaatttcaatatcattttctttcagcagaaagaaag |
185 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23178312 |
gtgtgaaaatggaatatgcatgatttccattaatttcaatttcattttctttcagcagaaagaaag |
23178377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 120 - 185
Target Start/End: Original strand, 23589569 - 23589634
Alignment:
| Q |
120 |
gtgtcaaaatggaatatgcatgatttccattaatttcaatatcattttctttcagcagaaagaaag |
185 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23589569 |
gtgtgaaaatggaatatgcatgatttccattaatttcaatttcattttctttcagcagaaagaaag |
23589634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University