View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17355_low_13 (Length: 266)
Name: NF17355_low_13
Description: NF17355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17355_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 26 - 252
Target Start/End: Complemental strand, 4725773 - 4725545
Alignment:
| Q |
26 |
tatatcataaggtgggaactgggaaatatgaaatgttgcnnnnnnnnntctcatcaaataatgttgcaacttaaatttagttccatgtcnnnnnnnnn-- |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4725773 |
tatatcataaggtgggaactgggaaatatgaaatgttgcaaaaaaaa-tctcatcaaataatgttgcaacttaaatttagttccatgtcaaaaaaaaaaa |
4725675 |
T |
|
| Q |
124 |
-cttaaatttagtgtatatatatgtacctcaataaaatagttaagataaattggtgtttggagaagctgtgactgattaattagtgttaatgcatgcaaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4725674 |
acttaaatttagtgtatatatatgtacctcaataaaatagttaagataaattggtgtatggagaagttgtgactgattaattagtgttaatgcatgcaaa |
4725575 |
T |
|
| Q |
223 |
gtatatattaccatgctattggtaattttt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4725574 |
gtatatattaccatgctattggtaattttt |
4725545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University