View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17355_low_4 (Length: 476)
Name: NF17355_low_4
Description: NF17355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17355_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 428; Significance: 0; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 428; E-Value: 0
Query Start/End: Original strand, 17 - 468
Target Start/End: Complemental strand, 39711675 - 39711224
Alignment:
| Q |
17 |
agaatcattattggtagaaggtggaggagtttcgctttgagcacttggtggtgaatcagtcttttcggtagcacttggtgaaggaggattctctttggta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39711675 |
agaatcattattggtagaaggtggaggagtttcgctttgagcacttggtggtgaatcagtcttttcggtagcacttggtgaaggagcattctctttggta |
39711576 |
T |
|
| Q |
117 |
gcacttggttccggagcattcaccaccggagaatttgttggggattgtaccggtgcgacctcagaaggtgaaggagcattcactggaggagaatttgttg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39711575 |
gcacttggttccggagcattcaccaccggagaattttttgcgaattgtaccggtgcgacctcagaaggtgaaggagcattcactggaggagaatttgttg |
39711476 |
T |
|
| Q |
217 |
gggagtgtaccggtgcagcctcagaaggtgaaggagcattccaggtcggtgattgtgatggggagcgtaccggtgcaatttcagaaggtgaaggagcatt |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39711475 |
gggagtgtaccggtgcagcctcagaaggtgaaggagcattccaggtcggtgattgtgatggggagcgtaccggtgcagtttcagaaggtgaaggagcatt |
39711376 |
T |
|
| Q |
317 |
ccatgacggagactgcgctggagccgtccaaccagcaaaacttggtgaaggagcattccaagccggtggttgtgctggggagtaagttggagagttccat |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39711375 |
ccatgacggagactgcgctggagccgtccaaccagcaaaacttggtgaaggagcattccaagccggtggttgtgctggggagtaagttggagagttccat |
39711276 |
T |
|
| Q |
417 |
gagggagacggtgctggggagtataccggtgcaaccatcagagatgatgatg |
468 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39711275 |
gagggagacggtgctggggagtataccggtgcaaccatcggagatgatgatg |
39711224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 356 - 452
Target Start/End: Complemental strand, 39704763 - 39704667
Alignment:
| Q |
356 |
acttggtgaaggagcattccaagccggtggttgtgctggggagtaagttggagagttccatgagggagacggtgctggggagtataccggtgcaacc |
452 |
Q |
| |
|
||||||||| |||||||| | ||||| |||||||| ||||||| | ||||| ||||||||||||||| || |||||||| |||||||||||| |
|
|
| T |
39704763 |
acttggtgagggagcatttcgagccgatggttgtgttggggagcgtgcaggagaattccatgagggagacaatgatggggagtgcaccggtgcaacc |
39704667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 350 - 398
Target Start/End: Complemental strand, 39704883 - 39704835
Alignment:
| Q |
350 |
agcaaaacttggtgaaggagcattccaagccggtggttgtgctggggag |
398 |
Q |
| |
|
||||| ||||| ||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
39704883 |
agcaacacttgatgagggagcattccaagccggtggttgtgttggggag |
39704835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 356 - 398
Target Start/End: Complemental strand, 39704991 - 39704949
Alignment:
| Q |
356 |
acttggtgaaggagcattccaagccggtggttgtgctggggag |
398 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||| ||||||| |
|
|
| T |
39704991 |
acttggtgagggagcattccaagctggtggttgtgttggggag |
39704949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 404 - 452
Target Start/End: Original strand, 39690512 - 39690560
Alignment:
| Q |
404 |
tggagagttccatgagggagacggtgctggggagtataccggtgcaacc |
452 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||| |||||||||||| |
|
|
| T |
39690512 |
tggagaattccatgagggagacgatgatggggagtgcaccggtgcaacc |
39690560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 350 - 398
Target Start/End: Complemental strand, 39704940 - 39704892
Alignment:
| Q |
350 |
agcaaaacttggtgaaggagcattccaagccggtggttgtgctggggag |
398 |
Q |
| |
|
||||| ||||| ||| |||||||||||||| |||||||||| ||||||| |
|
|
| T |
39704940 |
agcaacacttgatgagggagcattccaagctggtggttgtgttggggag |
39704892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 362 - 399
Target Start/End: Original strand, 14229481 - 14229518
Alignment:
| Q |
362 |
tgaaggagcattccaagccggtggttgtgctggggagt |
399 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
14229481 |
tgaaggagcattccaagctggtggttgtgcttgggagt |
14229518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 356 - 408
Target Start/End: Original strand, 38711160 - 38711212
Alignment:
| Q |
356 |
acttggtgaaggagcattccaagccggtggttgtgctggggagtaagttggag |
408 |
Q |
| |
|
||||||||||||||| |||||||| |||| ||||| |||||||| ||||||| |
|
|
| T |
38711160 |
acttggtgaaggagccttccaagcaggtgattgtgatggggagtgtgttggag |
38711212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University