View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17356_low_7 (Length: 364)
Name: NF17356_low_7
Description: NF17356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17356_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 276
Target Start/End: Complemental strand, 41825826 - 41825551
Alignment:
| Q |
1 |
aaatttcacccatttcaacctttgtttttcaatctcaaatgcttccacatgatagtttacctgttcttctcctaattgcaccaccctcttcttcatccat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41825826 |
aaatttcacccatttcaacctttgtttttcaatctcaaatgcttccacatgatagtttacctgttcttctcctaattgcaccaccttcttcttcatccat |
41825727 |
T |
|
| Q |
101 |
tgctttttctcccaacaactcttcactccatcttgcaacacactcatcacttcactactcaactgttgcatcacttgtgatggcaatgatgaaacttttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41825726 |
tgctttttctcccaacaactcttcactccatcttgcaacacactcatcacttcactactcaactgttgcatcacttgtgatggcaatgatgaaacttttc |
41825627 |
T |
|
| Q |
201 |
ttgattttttccttaagtgatcaatattttcatcttcttcatgtccctttgaaccataaccaccaccttctcctga |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41825626 |
ttgattttttccttaagtgatcaatattttcatcttcttcatgtccctttgaaccataaccaccaccttctcctga |
41825551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 95 - 143
Target Start/End: Original strand, 26919489 - 26919537
Alignment:
| Q |
95 |
atccattgctttttctcccaacaactcttcactccatcttgcaacacac |
143 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||| ||||||| |
|
|
| T |
26919489 |
atccattgctttttctcccaagtactcttacctccatcttgaaacacac |
26919537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University