View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17357_low_17 (Length: 326)
Name: NF17357_low_17
Description: NF17357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17357_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 151; Significance: 7e-80; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 153 - 307
Target Start/End: Complemental strand, 31832924 - 31832770
Alignment:
| Q |
153 |
cacttttagtaacaattttactgagatatggaagatgatgaatcaccacaactcaaaagtgttgttataatttctcttccaccttcaaataacccttctt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31832924 |
cacttttagtaacaattttactgagatatggaagatgatgaatcaccacaactcaagagtgttgttataatttctcttccaccttcaaataacccttctt |
31832825 |
T |
|
| Q |
253 |
taggtaaaaccataaccgcttttactttctttaaccctttttctcaacgacaact |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31832824 |
taggtaaaaccataaccgcttttactttctttaaccctttttctcaacgacaact |
31832770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 20 - 114
Target Start/End: Complemental strand, 31833054 - 31832960
Alignment:
| Q |
20 |
gtagttgctaggatccttcctttcttgttgaccaagtccagtctttagtaagactttctgccacacttggtggccaagttatcatcatcctcatt |
114 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31833054 |
gtagttgctacgatccttcctttcttgttgaccaagtccagtctttagtaagactttctgccacacttggtggccaagttatcatcatcctcatt |
31832960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University