View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17357_low_19 (Length: 309)
Name: NF17357_low_19
Description: NF17357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17357_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 134 - 295
Target Start/End: Complemental strand, 3215099 - 3214935
Alignment:
| Q |
134 |
aaatatctagttataaaatttgagaatgtaaggagcgaattgagaaattaccttataaaatttgcttcaagtctctaaatatatcggaccg---ctattg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3215099 |
aaatatctagttataaaatttgagaatgtaaggagcgaatagagaaattgccttataaaatttgcttcaagtctctaaatatatcggaccgactctattg |
3215000 |
T |
 |
| Q |
231 |
agtcggataaaaccacaatagaatgtaaaatctccctcaagtaaagtgtgaatgacatatttttt |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3214999 |
agtcggataaaaccacaatagaatgtaaaatctccctcaagtaaagtgtgaatgacatatttttt |
3214935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 5 - 83
Target Start/End: Complemental strand, 3215228 - 3215150
Alignment:
| Q |
5 |
attataaggtagattcttgtattttcaacctttgaaacaaacatcatttgtgatgcaaaattattccagaatattcatc |
83 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
3215228 |
attacaaggtagattcttgtatttgcaacctttgaaacaaacatcacttgtgatgcaaaataattccagaatattcatc |
3215150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University