View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17357_low_28 (Length: 259)
Name: NF17357_low_28
Description: NF17357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17357_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 19842747 - 19842992
Alignment:
| Q |
1 |
tcaagaatctttctaaaatat-----ttggctttgatttagttaatcaagggaatcaatagaaaagtagcaaaataaataggagttcttggtgcaaattg |
95 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19842747 |
tcaagaatctttctaaaatatcatatttggctttgatttagttaatcaagggaatcaattgaaaagtagcaaaataaataggaggtcttggtgcaaattg |
19842846 |
T |
 |
| Q |
96 |
atggaatacatttggcctgtttacaattatcgtactcctattaattatattttgcttatnnnnnnnntatacttttctccattgaatgagtgaaaatgta |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19842847 |
atggaatacatttggcctgtttacaattatcgtactcctattaattctattttgcttataaaaaaaa-atacttttctccattgaatgagtgaaaatgta |
19842945 |
T |
 |
| Q |
196 |
gaagaaagaaacaaaaatcgatgtcactttataacctttttcatttctt |
244 |
Q |
| |
|
|||||||||||||||| | |||||||||| |||||||||||||||||| |
|
|
| T |
19842946 |
gaagaaagaaacaaaagttgatgtcactt--taacctttttcatttctt |
19842992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University