View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17357_low_32 (Length: 244)
Name: NF17357_low_32
Description: NF17357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17357_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 47496062 - 47496284
Alignment:
| Q |
1 |
acgtgcttcattacgtacgttgtaggtttgaaattcatgtaattttaattatgtacctttgaaattattaagaaaaattaaatataactagaatattatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47496062 |
acgtgcttcattacgtacgttgtaggtttgaaattcatgtaatttttattatgtacctttgaatttattaagaaaaattaaatataactagaatattatt |
47496161 |
T |
|
| Q |
101 |
atatatgtgtgtcaacaacacattacatatctctttgaaaaatgaatctctaatattaaaatgagaattagtttcaatatcatattaaaacatatggttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47496162 |
atatatgtgtgtcaacaacacattacatatctc-ttgaaaaatgaatctctaatattaaaatgagaattagtttcaatatcatattaaaacatatggttg |
47496260 |
T |
|
| Q |
201 |
aaattaaaacactcaagaaagact |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
47496261 |
aaattaaaacactcaagaaagact |
47496284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University