View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17357_low_33 (Length: 223)
Name: NF17357_low_33
Description: NF17357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17357_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 37 - 211
Target Start/End: Original strand, 9799539 - 9799712
Alignment:
| Q |
37 |
aagatgagcatagtgatggctctgtcggtattgggtggttgcatgttacagtgctctattattatttgacacttgtctcaatatctttcaattttaattt |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9799539 |
aagatgagcatagtgatggctctgtcggtattgggtggttgcatggtacagtgctctattattatttgacacttgtctcaatatctttcaattttaattt |
9799638 |
T |
|
| Q |
137 |
aatacaaccgtgtgctgtaagatttgataatttgatactcacattcacattcgacctagtgccgaggttgatgat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| ||||||||||| |
|
|
| T |
9799639 |
aatacaaccgtgtgctgtaagatttgataatttgatactcaca-tcacattcgacccagtgcccaggttgatgat |
9799712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 90 - 167
Target Start/End: Complemental strand, 9831750 - 9831673
Alignment:
| Q |
90 |
ctctattattatttgacacttgtctcaatatctttcaattttaatttaatacaaccgtgtgctgtaagatttgataat |
167 |
Q |
| |
|
||||||||||||| ||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9831750 |
ctctattattattggacacttgtctcattatcattcaattttaatttaatacaaccgtgtgctgtaagatttgataat |
9831673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 18 - 56
Target Start/End: Complemental strand, 9831810 - 9831772
Alignment:
| Q |
18 |
ggaatttggagaaggtgggaagatgagcatagtgatggc |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9831810 |
ggaatttggagaaggtgggaagatgagcatagtgatggc |
9831772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 76 - 164
Target Start/End: Original strand, 9806373 - 9806461
Alignment:
| Q |
76 |
tgcatgttacagtgctctattattatttgacacttgtctcaatatctttcaa-ttttaatttaatacaaccgtgtgctgtaagatttgat |
164 |
Q |
| |
|
|||||| |||| ||||| ||||| ||| ||||||||||||| |||| ||||| |||||||| ||||| |||||| ||||| |||||||| |
|
|
| T |
9806373 |
tgcatggtacattgctcaattat-attggacacttgtctcattatcattcaatttttaattcaatactaccgtgagctgtttgatttgat |
9806461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University