View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17358_high_7 (Length: 270)
Name: NF17358_high_7
Description: NF17358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17358_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 19 - 253
Target Start/End: Complemental strand, 3520537 - 3520303
Alignment:
| Q |
19 |
gatgaagtcattttcgatttttctcatcttcatcctcttcgtcattgcatcaacattactaggtatttttctttctctattcttcaaaattcactgattc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3520537 |
gatgaagtcattttcgatttttctcatcttcatcctcttcgtcattgcatcaacattactaggtatttttctttctctattcttcaaaattcactgattc |
3520438 |
T |
 |
| Q |
119 |
cattgttcacataacacatcacagcattttcttcattcttcactttttgatctaaaatttgttcagatctacttaattttccccttcgattcatcaattt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3520437 |
tattgttcacataacacatcacagcattttcttcattcttaactttttgatctaaaatttgttcagatctacttaattttccccttcaattcatcaattt |
3520338 |
T |
 |
| Q |
219 |
ctatcattttaatttctaataatgtgtatttttct |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3520337 |
ctatcattttaatttctaataatgtgtatttttct |
3520303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University