View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17358_low_3 (Length: 432)
Name: NF17358_low_3
Description: NF17358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17358_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 1 - 416
Target Start/End: Complemental strand, 40961083 - 40960669
Alignment:
| Q |
1 |
atggatgaaagagtcggggtttaaacaaattatatttactctttactctaaaaatgtagtagactctttcaacggagcagtacatggtcaatctcgttag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |||| |
|
|
| T |
40961083 |
atggatgaaagagtcggggtttaaacaaattatatttactctttactctaaaaatgtagtagactttttcaacggagcagtgcatggtcaatctctttag |
40960984 |
T |
 |
| Q |
101 |
gttctattctatctaaatctcatagcattttatcgtcgtttttaataactcttatattaagttctttagaagagaagttaatatagttgttcataatttg |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40960983 |
gttctattttatctaaatctcatagcattttattgtcgtttttaataactcttatattgagttctttagaagagaagttaatatagttgttcataatctg |
40960884 |
T |
 |
| Q |
201 |
gcaaaagtggcaatatataacgcgtattctcaaccttatattggcatattggattgtctcgttgatttttagtgaaatgcagtagatcccccggacccgg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| ||||| || ||||||| |
|
|
| T |
40960883 |
gcaaaagtggcaatatataacgcgtattctcaaccttatattggtatattggattgtctcgttgatttttaatgaaatgcattagat-cctcggacccaa |
40960785 |
T |
 |
| Q |
301 |
tnnnnnnnnnnnnnttgcaattgatgcactttgttgggtctgttatttatactgttgtagttatcaatgaggtaaatattaataactaaggagtggggaa |
400 |
Q |
| |
|
| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40960784 |
taaaaataaatgaattgcaattgatgcaccttgttgggtctgttatttatactgttgtagttatcaatgaggtaaatattaataactaaggagtggggaa |
40960685 |
T |
 |
| Q |
401 |
attggttaaatttaac |
416 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
40960684 |
attggttaaatttaac |
40960669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University