View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17358_low_5 (Length: 303)
Name: NF17358_low_5
Description: NF17358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17358_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 3 - 284
Target Start/End: Original strand, 46465846 - 46466127
Alignment:
| Q |
3 |
aagatacactctgatgatatttttgcattatcgaaaaaattgctagcaagagaaattgattaaacttaccaacaattccatgcttgcaaacagaacacaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46465846 |
aagatacactctgatgatatttttgcattatcgaaaaaattgatagcaagagaaattgattaaacttaccaacaattccatgcttgcaaacagaacacaa |
46465945 |
T |
 |
| Q |
103 |
gtcttgaacctagacaaatatgtatcagaaattaatccacctaggagtggtagtaaaaaagcagttcccattaagttggttagggttgttgctgattttg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46465946 |
gtcttgaacctagacaaatatgtatcagaaattaatccacctaggagtggtagtaaaaaagcagttcccattaagttggttagggttgttgctgattttg |
46466045 |
T |
 |
| Q |
203 |
ttaagctgaagttcatggacccagtgaaataagttattaagctcactgcattggcaacaaaagccatgttctccaacccttc |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46466046 |
ttaagctgaagttcatggacccagtgaaataagttattaagctcactgcattggcaacaaaagccatgttctctaacccttc |
46466127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University