View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17358_low_7 (Length: 270)
Name: NF17358_low_7
Description: NF17358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17358_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 52 - 254
Target Start/End: Original strand, 29437094 - 29437309
Alignment:
| Q |
52 |
tttgagtggaaaaaccattcacgagttggtacgtacgggttcagatgctccaaaacgaattcaaattaaggcaattggagttatctatcc---------- |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29437094 |
tttgagtggaaaaaccattcacgagttggtacgtacgggttcagatgctccaaaacgaattcaaattaaggcaattggagttatctatcccactaggatt |
29437193 |
T |
|
| Q |
142 |
---aaaattctccattaacatgatcaacgacaataaacagtaaaaggnnnnnnngtttgtggaaggcaagaaatcgcaaagcaaacaacccctcgaggga |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29437194 |
tccaaaattctccattaacatgatcaacgacaataaacagtaaaaggaaaaaaagtttgtggaaggcaagaaatcgcaaagcaaacaacccctcgaggga |
29437293 |
T |
|
| Q |
239 |
aaacgggggaataaca |
254 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
29437294 |
aaacgggggaataaca |
29437309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 11 - 55
Target Start/End: Original strand, 29437026 - 29437070
Alignment:
| Q |
11 |
ttattctcttatcttggaattgtgaaagtgacttgtttatgtttg |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29437026 |
ttattctcttatcttggaattgtgaaagtgacttgtttatgtttg |
29437070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University