View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17359_low_10 (Length: 256)
Name: NF17359_low_10
Description: NF17359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17359_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 79 - 236
Target Start/End: Complemental strand, 27918086 - 27917929
Alignment:
| Q |
79 |
acaagaacacgatatttcttaactctaggttatacatagccagttaatatacggtacaggtgggtctacctctgtatacagcattcattgccattattcg |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27918086 |
acaagaacacgatatttcttaactctaggttacacatagccagttaatatacggtacaggtgggtctacctctgtatacagcattcattgccattattcg |
27917987 |
T |
 |
| Q |
179 |
ataggtcaattacttccctctcattagccaaaaatttcgtatactttagaggctgggc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27917986 |
ataggtcaattacttccctctcattagccaaaaatttcgtatactttagaggcagggc |
27917929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 85 - 216
Target Start/End: Complemental strand, 27896010 - 27895878
Alignment:
| Q |
85 |
acacgatatttcttaactctaggttatacatagccagttaatatacggtacaggtgggtctac-ctctgtatacagcattcattgccattattcgatagg |
183 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||| |||||| ||||||| ||||||||| | || || || ||||| |||| ||||||||||||| |
|
|
| T |
27896010 |
acacgatatttctgaactctaggttatacgtagccacttaatagacggtaccggtgggtctttgccctatacactgcatttattgatattattcgatagg |
27895911 |
T |
 |
| Q |
184 |
tcaattacttccctctcattagccaaaaatttc |
216 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
27895910 |
tcaattacttccatctcattagccaaaaatttc |
27895878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University