View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17359_low_13 (Length: 236)
Name: NF17359_low_13
Description: NF17359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17359_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 26 - 178
Target Start/End: Complemental strand, 32330274 - 32330122
Alignment:
| Q |
26 |
tgtacttgttttgttaatttggaatgtataggaaaaaattatatattttcaaaatggtggaatattcgtttatcatgcattcaaagtatatgtaactact |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32330274 |
tgtacttgttttgttaatttggaatgtataggaaaaaattatatattttcaaaatggtggaatattcgtttatcatgcattcaaagtatatgtaactact |
32330175 |
T |
|
| Q |
126 |
atattataatagattttgaatatctcttgtacttgcatcaacatattttgctt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32330174 |
atattataatagattttgaatatctcttgtacttgcatcaacatattttgctt |
32330122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University