View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17359_low_8 (Length: 298)
Name: NF17359_low_8
Description: NF17359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17359_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 9440658 - 9440551
Alignment:
| Q |
1 |
ccatttaacaagaaaaaggatgatgacaaagggaaggaggaagtgaaacacataaattgattgttatgtcttttgttcaagacacaacttgtgtttggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9440658 |
ccatttaacaagaaaaaggatgatgacaaagggaaggaggaagtgaaacacatagcttgattgttatgtcttttgttcaagacacaacttgtgtttggat |
9440559 |
T |
|
| Q |
101 |
tagctgta |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
9440558 |
tagctgta |
9440551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 9451884 - 9451792
Alignment:
| Q |
1 |
ccatttaacaagaaaaaggatgatgacaaagggaaggaggaagtgaaacacataaattgattgttatgtc-ttttgttcaagacacaacttgt |
92 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||||| || | || |||| ||||||||| |||||||||| ||| ||||||| |
|
|
| T |
9451884 |
ccatttaacaagaaaaaggatgacgacaaagggaaggagaaagtgcaagagatggcttgactgttatgtcattttgttcaacacaaaacttgt |
9451792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University