View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1735_low_7 (Length: 235)
Name: NF1735_low_7
Description: NF1735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1735_low_7 |
| |
|
[»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 235
Target Start/End: Original strand, 6388478 - 6388695
Alignment:
Q |
18 |
gagattatgtattttcgtagtctagtttcctggtttgttcgggcgccaagagatggtagaagatcactagacaaaaagctgctatgtgtataacttccca |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6388478 |
gagattatgtattttcgtagtctagtttcctggtttgttcgggcgccaagagatggtagaagatcactagacaaaaagctgctatgtgtataacttccca |
6388577 |
T |
|
Q |
118 |
tttccatttcgtccaaccagaacctctggaagacgtttttgagaccggaaaatgacatgttatgagtttagaagttgaatcctaaaagcttcaaaagagg |
217 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
T |
6388578 |
tttccatttcgtccaaccagaacctctggaagaagtttttgagaccggaaaatgacatgttatgagtttagaaattgaatcctcaaagcttcaaaagagg |
6388677 |
T |
|
Q |
218 |
taaagtagttaagttttt |
235 |
Q |
|
|
|| ||||||||||||||| |
|
|
T |
6388678 |
tatagtagttaagttttt |
6388695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3266 times since January 2019
Visitors: 1081