View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1735_low_8 (Length: 227)
Name: NF1735_low_8
Description: NF1735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1735_low_8 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 327754 - 327531
Alignment:
Q |
1 |
caaccatttgcatcaaactgcaaccgcagtttaaaaccatggtgcttctataatataaaaccttgcagcgtaactagaacacaacacgatttaaaattat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
327754 |
caaccatttgcatcaaactgcaaccgcagtttaaaaccatcgtgcttctataatataaaaccttgcagcgtaactaga--acaacacgatttaaaattat |
327657 |
T |
|
Q |
101 |
gacaataacataacatcattaatttcttgttnnnnnnntaatcattattccaaattgtgaaccg-----cattggagctggttccatggttttaaattgt |
195 |
Q |
|
|
||||||||||||| ||||||||||||||||| |||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
327656 |
gacaataacataatatcattaatttcttgttaaaaaaataatcattattctaaattgtgaaccgcatttcattggagctggttccatggttttaaattgt |
327557 |
T |
|
Q |
196 |
ggtagtaatgtctacaacaacactat |
221 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
327556 |
ggtagtaatgtctacaacaacactat |
327531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4711 times since January 2019
Visitors: 5911