View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17360_high_1 (Length: 246)
Name: NF17360_high_1
Description: NF17360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17360_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 31 - 232
Target Start/End: Original strand, 24664888 - 24665091
Alignment:
| Q |
31 |
gttattgacaaatgattagtgagtctaggttaaaaaatttgtgcatgctaaagggatcgagtgcttattaagtactattattagaagaagaaaaatataa |
130 |
Q |
| |
|
|||||||| |||||||||||| | | |||||||||||||||||||||||||| |||||||||||||||| || |||||||||||||| |||||||||| |
|
|
| T |
24664888 |
gttattgataaatgattagtggatttcagttaaaaaatttgtgcatgctaaaggaatcgagtgcttattaaatagtattattagaagaaaaaaaatataa |
24664987 |
T |
 |
| Q |
131 |
atgaata--atgtgtacccatgagacccattacatacacaaaatggatttctctatggtggatgcttttaacggtcattttacaaacatctatgatgaaa |
228 |
Q |
| |
|
|| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24664988 |
attcatataatgtgtacccatgagacccattacatacacaaaatggatttctctatggtggatgcttttaatggtcattttacaaacatctatgatgaaa |
24665087 |
T |
 |
| Q |
229 |
ttta |
232 |
Q |
| |
|
|||| |
|
|
| T |
24665088 |
ttta |
24665091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University