View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17360_high_1 (Length: 246)

Name: NF17360_high_1
Description: NF17360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17360_high_1
NF17360_high_1
[»] chr2 (1 HSPs)
chr2 (31-232)||(24664888-24665091)


Alignment Details
Target: chr2 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 31 - 232
Target Start/End: Original strand, 24664888 - 24665091
Alignment:
31 gttattgacaaatgattagtgagtctaggttaaaaaatttgtgcatgctaaagggatcgagtgcttattaagtactattattagaagaagaaaaatataa 130  Q
    |||||||| ||||||||||||  | |  |||||||||||||||||||||||||| |||||||||||||||| || |||||||||||||| ||||||||||    
24664888 gttattgataaatgattagtggatttcagttaaaaaatttgtgcatgctaaaggaatcgagtgcttattaaatagtattattagaagaaaaaaaatataa 24664987  T
131 atgaata--atgtgtacccatgagacccattacatacacaaaatggatttctctatggtggatgcttttaacggtcattttacaaacatctatgatgaaa 228  Q
    ||  |||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
24664988 attcatataatgtgtacccatgagacccattacatacacaaaatggatttctctatggtggatgcttttaatggtcattttacaaacatctatgatgaaa 24665087  T
229 ttta 232  Q
    ||||    
24665088 ttta 24665091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University