View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17361_low_6 (Length: 220)
Name: NF17361_low_6
Description: NF17361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17361_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 46 - 202
Target Start/End: Original strand, 14023253 - 14023409
Alignment:
| Q |
46 |
ttgcaagtgtgttgtttgatctttgtataacagagggatcttgaattcctgctagatcggaatcaagaagttatcatagtcaaacaacttttttcgtcca |
145 |
Q |
| |
|
|||||||| ||| |||||||||||||| ||||||||||||||||||||||||| | | |||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
14023253 |
ttgcaagtatgtgatttgatctttgtatgacagagggatcttgaattcctgctacaccagaatcatgaagttatcatagtcaaacaactttgttcgtcca |
14023352 |
T |
 |
| Q |
146 |
aatttgatcggagaaatcacttttcgaccttgtattttcttccgatgtactaatgtt |
202 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14023353 |
aatttgatcggagaaatcacatttcgaccttgtattttcgtccgatgtactaatgtt |
14023409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 94
Target Start/End: Original strand, 10462929 - 10462977
Alignment:
| Q |
46 |
ttgcaagtgtgttgtttgatctttgtataacagagggatcttgaattcc |
94 |
Q |
| |
|
||||||||||||| || |||||||||||| |||||||| ||||||||| |
|
|
| T |
10462929 |
ttgcaagtgtgttattggatctttgtatagtagagggattttgaattcc |
10462977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University