View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17362_high_3 (Length: 370)
Name: NF17362_high_3
Description: NF17362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17362_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 43890390 - 43890194
Alignment:
| Q |
1 |
taaatctaacaacgaagaaagtgtgaaattgttcgtaggtcaagtaccgaaacacatgacggaagatgagttacttacattgttcaaagaatttgctata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43890390 |
taaatctaacaacgaagaaagtgtgaaattgttcgtaggtcaagtaccgaaacacatgacggaagatgagttacttacattgttcaaagaatttgctata |
43890291 |
T |
 |
| Q |
101 |
gttgacgaagtcaacatcatcaaagacaaagctacacgcgcttctcgaggttcgttttcaaatctcgcattctccgctaattcttcaaatctactag |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43890290 |
gttgacgaagtcaacatcatcaaagacaaagctacacgcgcttctcgaggttcgttttcaaatctcgcattctccgctaattcttcaaatctactag |
43890194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 233 - 332
Target Start/End: Complemental strand, 43890156 - 43890057
Alignment:
| Q |
233 |
gtaggttgttgtttcgtgatttgtccttctagagatgaagctgataaggccgttaatgcgtgtcacaataagaaaacattaccaggggtgcgtatagtaa |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43890156 |
gtaggttgttgtttcgtgatttgtccttctagagatgaagctgataaggccgttaatgcgtgtcacaataagaaaacattaccaggggtgcgtatagtaa |
43890057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University