View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17363_high_11 (Length: 312)
Name: NF17363_high_11
Description: NF17363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17363_high_11 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 1 - 312
Target Start/End: Complemental strand, 8188406 - 8188095
Alignment:
| Q |
1 |
atcaaggttttcattttcatgagatgaaagaccgtcacgttctccaccctgtaatacagctgctagaaattttttatactcttcttcatcatcgacattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8188406 |
atcaaggttttcattttcatgagatgaaagaccgtcacgttctccaccctgtaatacagctgctagaaattttttatactcttcttcatcatcgacattt |
8188307 |
T |
|
| Q |
101 |
tgaacatcatcttcatcatcggtctcttgaagaaaggtctcaagctcatcaagactgaaaccttcaagcgaataacgagctctagtacgcatacaaatag |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8188306 |
tgaacatcatcttcatcatcagtctcttgaagaaaggtctcaagctcatcaagactgaaaccttcaagcgaataacgagctctagtacgcatacaaatag |
8188207 |
T |
|
| Q |
201 |
catcctcagtatctatgtctatcactgggcttcggggtttcgttgtgttgcttatgtcttctatcctaaaaccatcactagtaccactaatcaagtcatt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8188206 |
catcctcagtatctatgtctatcactgggcttcggggtttcgttgtgttgcttatgtcttctatcctaaaaccatcactagtaccactaatcaagtcatt |
8188107 |
T |
|
| Q |
301 |
cttcatctcctt |
312 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
8188106 |
cttcttctcctt |
8188095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University