View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17363_low_1 (Length: 396)
Name: NF17363_low_1
Description: NF17363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17363_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 17 - 369
Target Start/End: Original strand, 12359537 - 12359889
Alignment:
| Q |
17 |
agtgtcaaaggtttgggtgaaggtgatgcattggttgagatttactttcattactccgcctaannnnnnnaactatttggattgttggacagcacaatgg |
116 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12359537 |
agtgtcaaaggtttgggtgaaggtgattcattggttgagatttactttcattactccgcctaatttttttaactatttggattgttggacagcacaatgg |
12359636 |
T |
 |
| Q |
117 |
aggtctaagaaaattagacaggggttttggtagatttggcatgcttgtattttggtgatttggagggaaagaagcgagtctttaatgatcgctcaaagga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12359637 |
aggtctaagaaaattagacaggggttttggttgatttggcatgcttgtattttggtgatttggagggaaagaagcgagtctttaatgatcgcttaaagga |
12359736 |
T |
 |
| Q |
217 |
ggttaatgagttagctgaggagattaaagagttgccgtgacaatggagtttaaagagactgtctaaattgtattacctttatacgaatggatgtgcaatc |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12359737 |
ggttaatgagttagctgaggagattaaagagttgccgtgacaatggagtttaaagagactgtctaaattgtattacctttatacgaatggacgtgcaatc |
12359836 |
T |
 |
| Q |
317 |
cgcgcgattgcttgcaaatgggctaactgagttagttttgtattggtgtgcta |
369 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12359837 |
cgcgcaattgcttgcaaatgggctaactgagttagttttgtgttggtgtgcta |
12359889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University