View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17363_low_2 (Length: 307)
Name: NF17363_low_2
Description: NF17363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17363_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 8e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 47 - 242
Target Start/End: Original strand, 52244515 - 52244706
Alignment:
| Q |
47 |
gtgtcaagtagcgtagcggttaaaaattcaaaggtgtccgaagttcaaactcatccctacatattaaatatattgtaactatcaattgagctcggagatt |
146 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52244515 |
gtgtcaagtagcgtagcggttaaaaatt----ggtgtccgaagttcaaactcatccctacatattaaatatattgtaactatcaactgagctcggagatt |
52244610 |
T |
|
| Q |
147 |
tttcttatcgagtgaatagaagatattttggacaatcttcaattttgaaaattcgtcgaatttctcaactggcaaaaatatcgtccaattgaacag |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52244611 |
tttcttatcgagtgaatagaagatattttgaacaatcttcaattttgaaaattcgtcgaatttctcaactggcaaaaatatcgtccaattgaacag |
52244706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 265 - 306
Target Start/End: Original strand, 52244707 - 52244748
Alignment:
| Q |
265 |
ttagtcaactgcttgtgacttggcacattaagtggtctgtgc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52244707 |
ttagtcaactgcttgtgacttggcacattaagtggtctgtgc |
52244748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University