View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17363_low_4 (Length: 230)
Name: NF17363_low_4
Description: NF17363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17363_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 39788224 - 39788434
Alignment:
| Q |
1 |
tgacacctcttggacaaactctgaatccttgtgtgatttgcagtttttattttaatcgattcagatataatgaaaagtctaaatttgattgatcatagtc |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
39788224 |
tgacacctcttggacaaactcttaatccttgtgtgatttgcagtttttattttaatcgattcagatataatgacaagtctaaatttgattaatcatagtc |
39788323 |
T |
 |
| Q |
101 |
acataatgtgtgtcctttgtaaattatagtgatgccttgtgtgtgttttatggttctccggtggaatcggttagtcatttttgagcttgttactcatcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||||| |
|
|
| T |
39788324 |
acataatgtgtgtcctttgtaaattatagtgatgccttgtgtgtgttttatggttctccggtggaatcggttagtcatttat----ctgtcactcatcta |
39788419 |
T |
 |
| Q |
201 |
tggtatggtagtttt |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
39788420 |
tggtatggtagtttt |
39788434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University