View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17364_high_16 (Length: 271)
Name: NF17364_high_16
Description: NF17364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17364_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 18 - 265
Target Start/End: Original strand, 28600365 - 28600610
Alignment:
| Q |
18 |
aggaatgtctcatgaatgaaaatccgatgaccaatttcgttattccgagaccaaagatcaagtctatagtgatattctgcattggttcatcaaatttctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28600365 |
aggaatgtctcatgaatgaaaatccgatgaccaatttcgttattccaagaccaaagatcaagtctatagtgatattctgcattggttcatcaaatttctc |
28600464 |
T |
|
| Q |
118 |
aacctcaaatgtttcagctggaatctgcaatatgtaggaagagataaaattaaatacattaatttaaggaaatcatttaagccaagttattttcatttga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28600465 |
aacctcaaatgtttcagctggaatctgcaatatgtaggaagagataaaattaaatacattaatttgaggaaatcatttaagccaagttattttcatttg- |
28600563 |
T |
|
| Q |
218 |
aaaaatataaaatttccacactttgtcgcataaagctatattcttgga |
265 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
28600564 |
-aaaatataaaatttccacactttgtcacataaagctatatacttgga |
28600610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University