View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17364_low_23 (Length: 224)
Name: NF17364_low_23
Description: NF17364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17364_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 20 - 207
Target Start/End: Complemental strand, 33520674 - 33520487
Alignment:
| Q |
20 |
gaaactagtttaacataacagaaatagatgataacacatgttataggaatggaactcttaatagtcagaatctgtctctcgaaatggtaacggaactgtc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33520674 |
gaaactagtttaacataacagaaatagatgataacacatgttataggaatggaattcttaatagtcagaatctgtctctcgaaatggtaacggaactgtc |
33520575 |
T |
 |
| Q |
120 |
ttcactgctcggtaatggccgacattatttagatgctcattttccaacctgttgagaaaataacaaagttcttgagtcattctgtgat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33520574 |
ttcactgctcggtaatggccgacattattcagatgctcattttccaacctgatgagaaaataacaaatttcttgagtcattctgtgat |
33520487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 99 - 172
Target Start/End: Original strand, 15637786 - 15637859
Alignment:
| Q |
99 |
cgaaatggtaacggaactgtcttcactgctcggtaatggccgacattatttagatgctcattttccaacctgtt |
172 |
Q |
| |
|
||||| ||||| ||||||||||||||||||| |||||| || ||||| |||||||||||||| ||||||||||| |
|
|
| T |
15637786 |
cgaaagggtaatggaactgtcttcactgctctgtaatgaccaacattgtttagatgctcattctccaacctgtt |
15637859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University