View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17366_low_6 (Length: 269)
Name: NF17366_low_6
Description: NF17366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17366_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 16 - 253
Target Start/End: Original strand, 11990381 - 11990618
Alignment:
| Q |
16 |
atgagacactagtattttgagggactaacttggtttggtgcaaacaatctttatagggtttactttaatatttggaggaccaaataaaggttcaccctaa |
115 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
11990381 |
atgagacacaagtattttgagggactaacttggtttggtggaaacaatctttatagggtttactttaatatttggagggccaaataaaggttccccctaa |
11990480 |
T |
|
| Q |
116 |
actgtattttgcgtacaagttgataagtatttgaatgctccatcgtttatatgtttatctgtaaacaactaattctgatagatctactgataaagcttca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11990481 |
actgtattttgcgtacaagttgataagtatttgaatgctccatcgtttatatgtttatctataaacaactagctctgatagatctactgataaagcttca |
11990580 |
T |
|
| Q |
216 |
aacctgcatccctcccttctttgtcttttaacatatag |
253 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||| |
|
|
| T |
11990581 |
aacctgcatccttcccctcttcgtcttttaacatatag |
11990618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 28 - 167
Target Start/End: Original strand, 12020415 - 12020555
Alignment:
| Q |
28 |
tattttgagggactaacttggtttggtgcaaacaatctttata-gggtttactttaatatttggaggaccaaataaaggttcaccctaaactgtattttg |
126 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||| | ||| ||||| |||||||||||||||||||||| |||||| ||||| ||||||| | |
|
|
| T |
12020415 |
tattttgagggactaacttggtttggtggaaaaaatcttttgaagggattactcgaatatttggaggaccaaataaatgttcactctaaaatgtatttgg |
12020514 |
T |
|
| Q |
127 |
cgtacaagttgataagtatttgaatgctccatcgtttatat |
167 |
Q |
| |
|
| |||||| || ||||||||| | |||||| ||||||||| |
|
|
| T |
12020515 |
catacaaggagacaagtatttggaggctccaccgtttatat |
12020555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University