View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17366_low_8 (Length: 247)

Name: NF17366_low_8
Description: NF17366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17366_low_8
NF17366_low_8
[»] chr8 (1 HSPs)
chr8 (1-233)||(9475473-9475704)


Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 9475704 - 9475473
Alignment:
1 taattgtttatgcatttact--atgtcactaaatttttgttattcaatgcataattgcattgaggttaaattaggaacacttaacaaaattgatcttaaa 98  Q
    |||||||||||||||||||   ||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9475704 taattgtttatgcatttacaccatgtccctaattttttgttattcaatgcataattgcattgaggttaaattaggaacacttaacaaaattgatcttaaa 9475605  T
99 cgatgccccacttctcctttgtgaatactatttaactttttcattagatattcccttttgtgcacaaaaagttacnnnnnnnnnnnttaaaacatccttc 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||           ||||||||||||||    
9475604 cgatgccccacttctcctttgtgaatactatttaactttttcattagatattcccttttgtgcacaaaaagttac---aaaaaaaattaaaacatccttc 9475508  T
199 ttaaggggtcattaaaatgttgtgtccaaatttat 233  Q
    |||||||||||||||||||||||||||||||||||    
9475507 ttaaggggtcattaaaatgttgtgtccaaatttat 9475473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University