View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17366_low_8 (Length: 247)
Name: NF17366_low_8
Description: NF17366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17366_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 9475704 - 9475473
Alignment:
| Q |
1 |
taattgtttatgcatttact--atgtcactaaatttttgttattcaatgcataattgcattgaggttaaattaggaacacttaacaaaattgatcttaaa |
98 |
Q |
| |
|
||||||||||||||||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9475704 |
taattgtttatgcatttacaccatgtccctaattttttgttattcaatgcataattgcattgaggttaaattaggaacacttaacaaaattgatcttaaa |
9475605 |
T |
 |
| Q |
99 |
cgatgccccacttctcctttgtgaatactatttaactttttcattagatattcccttttgtgcacaaaaagttacnnnnnnnnnnnttaaaacatccttc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9475604 |
cgatgccccacttctcctttgtgaatactatttaactttttcattagatattcccttttgtgcacaaaaagttac---aaaaaaaattaaaacatccttc |
9475508 |
T |
 |
| Q |
199 |
ttaaggggtcattaaaatgttgtgtccaaatttat |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
9475507 |
ttaaggggtcattaaaatgttgtgtccaaatttat |
9475473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University