View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17367_high_18 (Length: 255)
Name: NF17367_high_18
Description: NF17367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17367_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 15 - 241
Target Start/End: Original strand, 24201174 - 24201400
Alignment:
| Q |
15 |
agattcatggtttgaagccggggattctagtggtaataatgatgatgatggtggnnnnnnnggcggtggtggcggtggaggtagagaactccagttgatc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24201174 |
agattcatggtttgaagccggggattctagtggtaataatgatgatggtggtggaaaaaaaggcggtggtggcggtggaggtagagaactccagttgatc |
24201273 |
T |
 |
| Q |
115 |
cgaggttctggatttggtggttgtgatggcagtagcgacggttgtgaagaccgctgattgatttgaggttcggagtttacaggttgaaattgtagcggtg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24201274 |
cgaggttctggatttggtggttgtgatggcagtagcgacggttgtgaagaccgctgattgattcgaggttctgagtttacaggttgaaattgtagcggtg |
24201373 |
T |
 |
| Q |
215 |
gtactgatcgtactgatagtcgtgatg |
241 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
24201374 |
gtactgatcgtactgatagtcgtgatg |
24201400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University