View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17367_high_20 (Length: 239)
Name: NF17367_high_20
Description: NF17367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17367_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 28 - 224
Target Start/End: Complemental strand, 51532754 - 51532558
Alignment:
| Q |
28 |
aatgttattaacaccaaaactctttgatccgatccgtgagtatgatgatgatgcatgaattaatgctagaggcgaaacagagagtttaaaattcacacac |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51532754 |
aatgttattaacaccaaaactctttgatccgatccgtgagtatgatgatgatgcatgaattaatgctagaggcgaaacagagagtttaaaattcacacac |
51532655 |
T |
|
| Q |
128 |
acaatgaaaagcatgttgaagatcatatacagaataaaagaactgaatatatctaataatcaagtacttattaataaattggggttaataataaccc |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51532654 |
acaatgaaaagcatgttgaagatcatatacagaataaaagaactgaaaatatctaataatcaagtacttattaataaattggggttaataataaccc |
51532558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University