View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17367_high_3 (Length: 459)
Name: NF17367_high_3
Description: NF17367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17367_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 290; Significance: 1e-162; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 290; E-Value: 1e-162
Query Start/End: Original strand, 1 - 331
Target Start/End: Complemental strand, 37916650 - 37916312
Alignment:
| Q |
1 |
atgtggaacaagagaataaacaagttcctgttgaagaggaacctcttttgataccagttatatcccagccgaattttgagcataatgtattccaaaacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37916650 |
atgtggaacaagagaataaacaagttcctgttgaagaggaacctcttttgataccagttatatcccagccgaattttgagcataatgtattccaaaacaa |
37916551 |
T |
|
| Q |
101 |
tattatacaagaggaactagctcatactggtacttcccatactgagaacccccttcccca--------gcaccgctacccggtgcttcagaatgtcttgg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37916550 |
tattatacaagaggaactagctcatactgatacttcccatactgagaacccccttccccagcacggcagcaccgctacccggtgcttcagaatgtcttgg |
37916451 |
T |
|
| Q |
193 |
aattgcttcgtcaaataagggctatgaaaaatgacgcttcaaacgaacattttacttctcatttgtcgaagaagcagaagaaacaactcaccaaagtcac |
292 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37916450 |
aattgcttcgtcaaataagggctacgaaaaatgacgcttcaaacgaacattttactcctcatttgttgaagaagcagaagaaacaactcaccaaagtcac |
37916351 |
T |
|
| Q |
293 |
tacacacaacatccgttccaagggcgactgaggagcata |
331 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37916350 |
tacacacaacacccgttccaagggcgactgaggagcata |
37916312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University