View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17367_high_9 (Length: 378)
Name: NF17367_high_9
Description: NF17367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17367_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 19 - 359
Target Start/End: Complemental strand, 4623454 - 4623114
Alignment:
| Q |
19 |
atgaagaagttgatgaggttgaagaagagggtcagtaagtgatctagctctagaactagaactacgaggcaaaacattactaccattattactcctcttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4623454 |
atgaagaagttgatgaggttgaagaagagggtcagtaagtgatctagctctagaactagaactacgaggcaaaacattactaccattattactcctcttt |
4623355 |
T |
|
| Q |
119 |
gaagcaccatttggataacgtaacgaacttgatcgatcaaattgttgattctgttgatgctgtttatacaacaaagcagcagctattgcttgttctcgaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4623354 |
gaagcaccatttggataacgtaacgaacttgatcgatcaaattgttgattctgttgatgctgtttatacaacaaagcagctgctattgcttgttctcgaa |
4623255 |
T |
|
| Q |
219 |
tcacagcgtcgtcgagtttcttcttctctctgcggtttgttgaagctgctgagtaacgctgttgttgctttttggatgaagaagaaagtgatttttgttg |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4623254 |
tcacagcgtcgtcgagtttcttcttctctctgcggcttgttgaagctgctgagtaacgctgttgttgctttttggatgaagaagaaagtgatttttgttg |
4623155 |
T |
|
| Q |
319 |
ttgggttggtttgagaagagagcagagattacccattgttg |
359 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4623154 |
ttgggttggtttgagaagagaacagagattacccattgttg |
4623114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University