View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17367_low_17 (Length: 267)
Name: NF17367_low_17
Description: NF17367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17367_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 42987079 - 42987314
Alignment:
| Q |
1 |
ttttttaaattctttgtagtatcttggcagaaatcttaatctcatcagcataaagagaatgagtttgagtttgacactcctatgattagctggacattgg |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42987079 |
ttttttaaattctttttagtatcttggcagaaatcgtaatctcatcagtataaagagaatgagtatgagtttgacactcctatgattagctggacattgg |
42987178 |
T |
|
| Q |
101 |
tttcatggatctttggttttcaaaatttattttcaatgaaaatccttaattttaatttttataaatgatatgtgccataatagatatcatttgccaatcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |
|
|
| T |
42987179 |
----------------ttttcaaaatttattttcaatgaaaatccttaattttaatttttataaacgatatgtgccataatagatatcatttgccaaccg |
42987262 |
T |
|
| Q |
201 |
agattgatctagttgataagtagttgacttatattttacaaagggtgaattc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42987263 |
agattgatctagttgataagtagttgacttatattttacaaagggtgaattc |
42987314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 113 - 158
Target Start/End: Complemental strand, 35088194 - 35088150
Alignment:
| Q |
113 |
ttggttttcaaaatttattttcaatgaaaatccttaattttaattt |
158 |
Q |
| |
|
||||||||||||||||||||||| || ||||||| ||||||||||| |
|
|
| T |
35088194 |
ttggttttcaaaatttattttcagtg-aaatcctgaattttaattt |
35088150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University