View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17368_low_10 (Length: 246)
Name: NF17368_low_10
Description: NF17368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17368_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 12 - 227
Target Start/End: Complemental strand, 45546067 - 45545853
Alignment:
| Q |
12 |
aagcatagggattgatcnnnnnnncattataaaataaacacttgcctaacactgtaaaagagaatcgaaaacactaacgtttcatcggcaatagtaatgt |
111 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45546067 |
aagcatagggattgatcaaaaacacattataaaataa-cacttgcctaacactgtaaaagagaatcgaaaacactaacgtttcatcggcaatagtaatgt |
45545969 |
T |
 |
| Q |
112 |
cacgctttggaacagtctcattgttgctctttcttcggatgctcatggttgaagacacattcttaacaactccaactaaatctgaaatccacaacaaata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45545968 |
cacgctttggaacagtctcattgttgctctttctacggatgctcatggttgaagacacattcttaacaactccaactaaatctgaaatccacaacaaata |
45545869 |
T |
 |
| Q |
212 |
aacaataagatgacaa |
227 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
45545868 |
aacaataagatgacaa |
45545853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University