View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17368_low_9 (Length: 299)
Name: NF17368_low_9
Description: NF17368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17368_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 18 - 287
Target Start/End: Complemental strand, 1395303 - 1395034
Alignment:
| Q |
18 |
cttctgagaaagataaacatccaacaaaaaccctaaaggattaaatgcttccctgagttctgagtgagttatggttttcgaaaagtttgtgaaataaaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1395303 |
cttctgagaaagataaacatccaacaaaaaccctaaaggattaaatgcttccctgaattctgagtgagttatggttttcgaaaagtttgtgaaataaaaa |
1395204 |
T |
|
| Q |
118 |
gaaacgacatcgattaaaccattagaacactttgttgtagcgctccacttgaatttgtcgtcgtctccatactttcttgaataaaacaaacttgtcttgt |
217 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
1395203 |
gaaacgacatcgattgaaccattagaacactttgttgtagcgttccacttgaatttgtcgtcgtcgcaatactttcttgaataaaacaaacttgtcttgt |
1395104 |
T |
|
| Q |
218 |
cttctcaatcccggttgagccgctttttgacgtcgatgtatcaccacggaccaaaagctctctctcccta |
287 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1395103 |
cttctcaatcccagttgagccgctttttgacgtcgatgtatcaacacggaccaaaagctctctctcccta |
1395034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University