View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17371_high_10 (Length: 208)
Name: NF17371_high_10
Description: NF17371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17371_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 81 - 184
Target Start/End: Complemental strand, 23148772 - 23148665
Alignment:
| Q |
81 |
gctaatttaactaaaaaattgttactttcacttccaagtggctctttatttgtattact----caattacatgtagttatcatggtagcatgcatgcata |
176 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23148772 |
gctaatttaactcaaaaattgttactttcacttccaagtggctctttatttgtattactcaatcaattacatgtagttatcatggtagcatgcatgcata |
23148673 |
T |
 |
| Q |
177 |
atgaagac |
184 |
Q |
| |
|
|||||||| |
|
|
| T |
23148672 |
atgaagac |
23148665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University