View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17371_high_4 (Length: 251)
Name: NF17371_high_4
Description: NF17371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17371_high_4 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 19 - 251
Target Start/End: Complemental strand, 35285901 - 35285671
Alignment:
| Q |
19 |
gtgggattctatttccagtttttgggattaaattagttatgatatatgtcannnnnnnnnnnnnccaggccatttttagatggcatgcatccagccatat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35285901 |
gtgggattctatttccagtttttgggattaaattagttatgatatatgtcatttttttcttcttccaggccatttttagatggcatgcatccagccatat |
35285802 |
T |
|
| Q |
119 |
cctttgttttcattaggttatttaagnnnnnnnnnnnnnnnnnnnccatattacatacattaattagtaggtatattgattgctcattttcaattgaaag |
218 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35285801 |
cctttgttttcattaggttatttaagttttttttttttctttt--ccatattacatacattaattagtaggtatattgattgctcattttcaattgaaag |
35285704 |
T |
|
| Q |
219 |
ttttcgtattacatatttcctcccgtcacattt |
251 |
Q |
| |
|
| ||||||||||||||||||||| ||||||||| |
|
|
| T |
35285703 |
tcttcgtattacatatttcctccggtcacattt |
35285671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University