View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17372_high_12 (Length: 233)
Name: NF17372_high_12
Description: NF17372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17372_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 19 - 216
Target Start/End: Original strand, 19389203 - 19389398
Alignment:
| Q |
19 |
atgacagataggctcatttatggtaaacaaaggaattgtgtttttcttttgattgtaatttatgaatcagtcagtcacacaaataccagacac--atact |
116 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
19389203 |
atgaccgataggctcatttatggtaaacaaaggaattgtgtttttcttttgattgtaatttatgaatcagtcat----acaaataccagacacacatact |
19389298 |
T |
 |
| Q |
117 |
gacattgacacatcgacacaagttaagaaaataaaagtaattaaatgtatatgtgtagtgtcagacaccttacatggtttcaatctgacgtgtcggtgct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19389299 |
gacattgacacatcgacacaagttaagaaaataaaagtaattaaatgtatatgtgtagtgtcagacaccttacatggtttcaatctgacgtgtcggtgct |
19389398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University