View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17372_low_13 (Length: 268)
Name: NF17372_low_13
Description: NF17372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17372_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 7296101 - 7296347
Alignment:
| Q |
1 |
acaaacaaacaacggcaaccctataataggccacaaatttaacctctctttctaaaatcatcttcaacaaaatgtcacaaaatagaaaattctacgaagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7296101 |
acaaacaaacaacggcaaccctataataggccacaaatttaacctctctttctaaaatcatcttcaacaaaatgtcaaaaaatagaaaattctacgaagg |
7296200 |
T |
|
| Q |
101 |
tggttcatgtttgtattacgagtacttttcgaaccccttcctttatatgttattttaggtga---gtgttgttgttgtttatatttaggtcgaatttccc |
197 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
7296201 |
tggttcatgtttgtattacgagtgcttttcgaaccccttcctttatatgttattttaggtgattgttgttgttgttgtttatatttaggtcgaatatcct |
7296300 |
T |
|
| Q |
198 |
taatacttctcctcggttaatgagtcaagtattaactatatgtcttt |
244 |
Q |
| |
|
| |||||||||||| ||| |||||||||||||||||||||| ||||| |
|
|
| T |
7296301 |
tgatacttctcctcagttgatgagtcaagtattaactatatttcttt |
7296347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University