View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17373_high_26 (Length: 217)
Name: NF17373_high_26
Description: NF17373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17373_high_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 15 - 202
Target Start/End: Original strand, 45361796 - 45361983
Alignment:
| Q |
15 |
tattctctcccgatcaatgctccggcatcaatcgcttggttgctctgtttgcagttcctttactttcattccatttcattgcctctaacaatccttacaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45361796 |
tattctctcccgatcaatgctccggcatcaatcgcttcgttgctctgtttgcagttcctttactttcattccatttcattgcctctaacaatccttacaa |
45361895 |
T |
 |
| Q |
115 |
aatgaacacacgcttcctcgtcgcagacacacttcaaaagattaacgtcttacttgctctcaccatttgggccaacgtcagcaaaagg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45361896 |
aatgaacacacgcttcctcgtcgcagacacacttcaaaagattatcgtcttacttgctctcaccatttgggccaacgtcagcaaaagg |
45361983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 26 - 121
Target Start/End: Original strand, 25038627 - 25038722
Alignment:
| Q |
26 |
gatcaatgctccggcatcaatcgcttggttgctctgtttgcagttcctttactttcattccatttcattgcctctaacaatccttacaaaatgaac |
121 |
Q |
| |
|
|||||||| || || ||||| || || ||||| || ||||||||||| | ||||||||||||||||| || || ||||||||||||||||||||| |
|
|
| T |
25038627 |
gatcaatgttcaggaatcaaccgttttgttgcactctttgcagttccacttctttcattccatttcatagcatcaaacaatccttacaaaatgaac |
25038722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University